Primers

We've used several primers to amplify and alter our bricks that we have. Below you can find a whole list of primers sorted by their use!

Amplification primers

NameSequence
Amplification1_FGACGCCAGGTTGAAT-GAATTCGCGGCCGCTT
Amplification1_RCCGTATTTGGAGGTA-CTGCAGCGGCCGCTA
Amplification_Brick2_FGACGCCAGGTTGAAT-GAATTCGCGGCCGCTTCTAGAACATTGATTATTTGC
Amplification_Brick2_RCCGTATTTGGAGGTA-CTGCAGCGGCCGCTACTAGTAGCT

Sequencing primers

NameSequence
Seq_P1_RGAGTTCGAAATCGAAGGTGAAGG
Seq_P1_FCCTTCACCTTCGATTTCGAAC
Seq_P2_RTTTATCGCCGCCAACAATTTG
Seq_P2_FTTAGATGGTGATGTTAATGGGC
Seq_P3_FTTAGATGGTGATGTTAATGGGC
Seq_P3_RGTTGCATCACCTTCACCCTCTC
VF2TGCCACCTGACGTCTAAGAA
VRATTACCGCCTTTGAGTGAGC

New amplification primers

NameSequence
Max_primer_BB1/BB1.2_FGACGCCAGGTTGAAT-GAATTCGCGGCCGCTTCTAGAATTTCAG
Max_primer_BB1/BB1.2_RCCGTATTTGGAGGTA-CTGCAGCGGCCGCTACTAGTATGG
Tobi_BB2_FGACGCCAGGTTGAAT-GAATTCGCGGCCGCTTCTAGAACATTGATTATTTGC
Tobi_BB2_RCCGTATTTGGAGGTA-CTGCAGCGGCCGCTACTAGTAGC
Tobi_BB3_FGACGCCAGGTTGAAT-GAATTCGCGGCCGCTTCTAGAGACTATCTTC
Tobi_BB3_RCCGTATTTGGAGGTA-CTGCAGCGGCCGCTACTAGTAAGG

Overlap extension and HIFI primer

NameSequence
OE_1_1+2_F_0008CGCCAGGTTGAATGAATTCGC
OE_1_1+2_R_0009CAAATAATCAATGTTGGCCGGCTTGACGG
OE_2_1+2_F_00010GTCAAGCCGGCCAACATTGATTATTTGCACGGCGTCAC
OE_2_1+2_R_00011GTATTTGGAGGTACTGCAGCGG
OE_1_1+3_F_00012CGCCAGGTTGAATGAATTCGC
OE_1_1+3_R_00013CGAGAAGATAGTCTTGACGGCTAGCTCAGTCCT
OE_3_1+3_F_00014AGCTAGCCGTCAAGACTATCTTCTCGCTTATCGTGTT
OE_3_1+3_R_00015GTATTTGGAGGTACTGCAGCGG
OE_1.2_1.2+3_FCGCCAGGTTGAATGAATTCGC
OE_1.2_1.2+3_RGCGAGAAGATAGTCGGCACATTGATTATTTGCACGG
OE_3_1.2+3_FATAATCAATGTGCCGACTATCTTCTCGCTTATCGTGTTTGACA
OE_3_1.2+3_RGTATTTGGAGGTACTGCAGCGG

New OE primers

NameSequence
OE_2_1+2_F_00010GTCAAGCCGGCCAACATTGATTATTTGCACGGCGTCAC
OE_2_1+2_R_00011GTATTTGGAGGTACTGCAGCGGC

HIFI primers AraC3 Linearization Vectors

Linearization for Vector to be complementary to OE primer amplified BB (OE)

Vector_openingRBB1_1.2_2_3CGAATTCATTCAACCTGGCGTC-CGGGTATGGAGAAACAGTAGAGAGTTGC
Vector_openingFBB1_1.2_2_3GCTGCAGTACCTCCAAATACGG-CGCGTTATGCAGGCTTCCTCGC
Vector opening 1.2+3 FCTAGGACTGAGCTAGCCGTCAAGCC
Vector opening 1.2+3 RGTTGAACAGTACGAACGTGCCGAGG
Delete BB2 FTTTGTAACAGCTGCTGGGATTACACATGGC
Delete BB2 RCGGCTTGACGGCTAGCTCAGTCC

Linearization for Vector to be complementary to Amplified BB (BB)

Vector_openingRBB1_1.2_2_3CGAATTCATTCAACCTGGCGTC-CGGGTATGGAGAAACAGTAGAGAGTTGC
Vector_openingFBB1_1.2_2_3GCTGCAGTACCTCCAAATACGG-CGCGTTATGCAGGCTTCCTCGC

Deletion primer

NameSequence
BB1 FCTAGGACTGAGCTAGCCGTCAAGCC
BB1 RGTTGAACAGTACGAACGTGCCGAGG
BB2 FTTTGTAACAGCTGCTGGGATTACACATGGC
BB2 RCGGCTTGACGGCTAGCTCAGTCC

Primer to add RBS

NameSequence
RBS3 to RFP FAGCCATCTAGTACGTCATGTCTTTCTTATTATTTGTCGTCGTCG
RBS3 to RFP RATGTGACCGACTGTGAATCTG
RBS3 to GFP FACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCC
RBS3 to GFP RACGTCATGTCTTTCTTATTACAGATCTTCTTCGCTAATCAGTTTCTG

NO-Sensing System Primers

NameSequence
Amp1ATCGCTAATGTGAGCCCATC
Amp2ATGTGACCGACTGTGAATCTG
Cutout FCCCATCGTGGTCCTCAGATA
Cutout RCTGCAGCGGCCGCTACTAGTAGTACTTCGCCACTAATTCCACA
Sens_Opti FATCGCTAATGTGAGCCCATCGTGGTCC
Sens_Opti RCAATGTGACCGACTGTGAATCTGCAGCGG
Alternative_1CAGATATGAATTCGCGGCCGCTTCTAGAGTGTGGAATTAGTGGCGAAGTACGATTCC